Review



mda mb 231 expressing phred  (ATCC)


Bioz Verified Symbol ATCC is a verified supplier
Bioz Manufacturer Symbol ATCC manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 99
      Buy from Supplier

    Structured Review

    ATCC mda mb 231 expressing phred
    Mda Mb 231 Expressing Phred, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 24506 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mda+mb+231+expressing+phred/MDA-MB-231/pm41686638-283-179-188
    Average 99 stars, based on 24506 article reviews
    mda mb 231 expressing phred - by Bioz Stars, 2026-09
    99/100 stars

    Images

    Related Articles

    In Situ:

    Article Title: Hypoxia restores the acidosis-induced inhibition of cancer cell dissemination.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER latrunculin A Millipore Sigma 2-Deoxy-D-Glucose Cayman Chemical Cat # 14325 n-acetyl cysteine Cayman Chemical Cat # 20261 etomoxir Cayman Chemical Cat # 11969 oligomycin Cayman Chemical Cat # 11342 rotenone Cayman Chemical Cat # 13995 antimycin A Cayman Chemical Cat # 34799 NaHCO3 Gibco Cat # 12800-058 LIVE/DEADTM Viability/Cytotoxicity Kit Invitrogen Cat #L3224 BCECF-AM Thermo Fisher Cat #B1170 pHrodoTM Red-AM Molecular Probes Cat #P35372 Tetramethylrhodamine methyl ester perchlorate Thermo Fisher Cat #T668 Glucose Agilent Cat # 103577-100 Pyruvate Agilent Cat # 103578-100 Glutamine Agilent Cat # 103579-100 Seahorse XF DMEM Medium Agilent Cat # 103575-100 BODIPY Thermo Fisher Cat #D3922 CellROXTM Deep Red Reagent Thermo Fisher Cat #C10422 2-[4-(2-hydroxyethyl)piperazin-1-yl]ethanesulfonic acid Gibco Cat # 15630080 PIPES Millipore Sigma Cat #P1851 Critical commercial assays Duolink In Situ Red Starter Kit Mouse/Rabbit Sigma-Aldrich Cat # DUO92101 Cell Counting Kit-8 Dojindo Cat # CK04-11 Deposited data RNA-seq analysis This paper https://github.com/bajpai-lab/Acidosis-Cancer- RNAseq RNA-seq raw data This paper GSE315655 (see https://www.ncbi.nlm.nih.gov/ geo/query/acc.cgi?acc=GSE315655) Experimental models: Cell lines MDA-MB-231 wild-type ATCC Cat # HTB-26 MDA-MB-231 expressing Lifeact-GFP (Bera et al.)20 N/A MDA-MB-231 expressing pHred (Bera et al.)20 N/A HT1080 wild-type ATCC Cat # CCL-121 HCT116 ATCC Cat # CCL-247 A375 ATCC Cat # CRL-1619 HOS ATCC Cat # CRL-1543 Experimental models: Organisms/strains NOD-SCID Gamma (NSG) mice Jackson Laboratory strain #005557 Chick embryo University of Alberta poultry research facility Gallus gallus Oligonucleotides shRNA targeting human EZRIN CCGTGGGATGCTCAAAGATAA This paper N/A ShRNA targeting human NHE1 (1) GACAAGCTCAACCGGTTTAAT ShRNA targeting human NHE1 (2) CCAATCTTAGTTTCTAACCAA This paper N/A non-targeting scramble control GCACTACCAGAGCTAACTCAGATAGTACT This paper N/A (Continued on next page) 18 Cell Reports 45, 116970, February 24, 2026

    CCK-8 Assay:

    Article Title: Hypoxia restores the acidosis-induced inhibition of cancer cell dissemination.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER latrunculin A Millipore Sigma 2-Deoxy-D-Glucose Cayman Chemical Cat # 14325 n-acetyl cysteine Cayman Chemical Cat # 20261 etomoxir Cayman Chemical Cat # 11969 oligomycin Cayman Chemical Cat # 11342 rotenone Cayman Chemical Cat # 13995 antimycin A Cayman Chemical Cat # 34799 NaHCO3 Gibco Cat # 12800-058 LIVE/DEADTM Viability/Cytotoxicity Kit Invitrogen Cat #L3224 BCECF-AM Thermo Fisher Cat #B1170 pHrodoTM Red-AM Molecular Probes Cat #P35372 Tetramethylrhodamine methyl ester perchlorate Thermo Fisher Cat #T668 Glucose Agilent Cat # 103577-100 Pyruvate Agilent Cat # 103578-100 Glutamine Agilent Cat # 103579-100 Seahorse XF DMEM Medium Agilent Cat # 103575-100 BODIPY Thermo Fisher Cat #D3922 CellROXTM Deep Red Reagent Thermo Fisher Cat #C10422 2-[4-(2-hydroxyethyl)piperazin-1-yl]ethanesulfonic acid Gibco Cat # 15630080 PIPES Millipore Sigma Cat #P1851 Critical commercial assays Duolink In Situ Red Starter Kit Mouse/Rabbit Sigma-Aldrich Cat # DUO92101 Cell Counting Kit-8 Dojindo Cat # CK04-11 Deposited data RNA-seq analysis This paper https://github.com/bajpai-lab/Acidosis-Cancer- RNAseq RNA-seq raw data This paper GSE315655 (see https://www.ncbi.nlm.nih.gov/ geo/query/acc.cgi?acc=GSE315655) Experimental models: Cell lines MDA-MB-231 wild-type ATCC Cat # HTB-26 MDA-MB-231 expressing Lifeact-GFP (Bera et al.)20 N/A MDA-MB-231 expressing pHred (Bera et al.)20 N/A HT1080 wild-type ATCC Cat # CCL-121 HCT116 ATCC Cat # CCL-247 A375 ATCC Cat # CRL-1619 HOS ATCC Cat # CRL-1543 Experimental models: Organisms/strains NOD-SCID Gamma (NSG) mice Jackson Laboratory strain #005557 Chick embryo University of Alberta poultry research facility Gallus gallus Oligonucleotides shRNA targeting human EZRIN CCGTGGGATGCTCAAAGATAA This paper N/A ShRNA targeting human NHE1 (1) GACAAGCTCAACCGGTTTAAT ShRNA targeting human NHE1 (2) CCAATCTTAGTTTCTAACCAA This paper N/A non-targeting scramble control GCACTACCAGAGCTAACTCAGATAGTACT This paper N/A (Continued on next page) 18 Cell Reports 45, 116970, February 24, 2026

    RNA Sequencing:

    Article Title: Hypoxia restores the acidosis-induced inhibition of cancer cell dissemination.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER latrunculin A Millipore Sigma 2-Deoxy-D-Glucose Cayman Chemical Cat # 14325 n-acetyl cysteine Cayman Chemical Cat # 20261 etomoxir Cayman Chemical Cat # 11969 oligomycin Cayman Chemical Cat # 11342 rotenone Cayman Chemical Cat # 13995 antimycin A Cayman Chemical Cat # 34799 NaHCO3 Gibco Cat # 12800-058 LIVE/DEADTM Viability/Cytotoxicity Kit Invitrogen Cat #L3224 BCECF-AM Thermo Fisher Cat #B1170 pHrodoTM Red-AM Molecular Probes Cat #P35372 Tetramethylrhodamine methyl ester perchlorate Thermo Fisher Cat #T668 Glucose Agilent Cat # 103577-100 Pyruvate Agilent Cat # 103578-100 Glutamine Agilent Cat # 103579-100 Seahorse XF DMEM Medium Agilent Cat # 103575-100 BODIPY Thermo Fisher Cat #D3922 CellROXTM Deep Red Reagent Thermo Fisher Cat #C10422 2-[4-(2-hydroxyethyl)piperazin-1-yl]ethanesulfonic acid Gibco Cat # 15630080 PIPES Millipore Sigma Cat #P1851 Critical commercial assays Duolink In Situ Red Starter Kit Mouse/Rabbit Sigma-Aldrich Cat # DUO92101 Cell Counting Kit-8 Dojindo Cat # CK04-11 Deposited data RNA-seq analysis This paper https://github.com/bajpai-lab/Acidosis-Cancer- RNAseq RNA-seq raw data This paper GSE315655 (see https://www.ncbi.nlm.nih.gov/ geo/query/acc.cgi?acc=GSE315655) Experimental models: Cell lines MDA-MB-231 wild-type ATCC Cat # HTB-26 MDA-MB-231 expressing Lifeact-GFP (Bera et al.)20 N/A MDA-MB-231 expressing pHred (Bera et al.)20 N/A HT1080 wild-type ATCC Cat # CCL-121 HCT116 ATCC Cat # CCL-247 A375 ATCC Cat # CRL-1619 HOS ATCC Cat # CRL-1543 Experimental models: Organisms/strains NOD-SCID Gamma (NSG) mice Jackson Laboratory strain #005557 Chick embryo University of Alberta poultry research facility Gallus gallus Oligonucleotides shRNA targeting human EZRIN CCGTGGGATGCTCAAAGATAA This paper N/A ShRNA targeting human NHE1 (1) GACAAGCTCAACCGGTTTAAT ShRNA targeting human NHE1 (2) CCAATCTTAGTTTCTAACCAA This paper N/A non-targeting scramble control GCACTACCAGAGCTAACTCAGATAGTACT This paper N/A (Continued on next page) 18 Cell Reports 45, 116970, February 24, 2026

    Multiple Displacement Amplification:

    Article Title: Hypoxia restores the acidosis-induced inhibition of cancer cell dissemination.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER latrunculin A Millipore Sigma 2-Deoxy-D-Glucose Cayman Chemical Cat # 14325 n-acetyl cysteine Cayman Chemical Cat # 20261 etomoxir Cayman Chemical Cat # 11969 oligomycin Cayman Chemical Cat # 11342 rotenone Cayman Chemical Cat # 13995 antimycin A Cayman Chemical Cat # 34799 NaHCO3 Gibco Cat # 12800-058 LIVE/DEADTM Viability/Cytotoxicity Kit Invitrogen Cat #L3224 BCECF-AM Thermo Fisher Cat #B1170 pHrodoTM Red-AM Molecular Probes Cat #P35372 Tetramethylrhodamine methyl ester perchlorate Thermo Fisher Cat #T668 Glucose Agilent Cat # 103577-100 Pyruvate Agilent Cat # 103578-100 Glutamine Agilent Cat # 103579-100 Seahorse XF DMEM Medium Agilent Cat # 103575-100 BODIPY Thermo Fisher Cat #D3922 CellROXTM Deep Red Reagent Thermo Fisher Cat #C10422 2-[4-(2-hydroxyethyl)piperazin-1-yl]ethanesulfonic acid Gibco Cat # 15630080 PIPES Millipore Sigma Cat #P1851 Critical commercial assays Duolink In Situ Red Starter Kit Mouse/Rabbit Sigma-Aldrich Cat # DUO92101 Cell Counting Kit-8 Dojindo Cat # CK04-11 Deposited data RNA-seq analysis This paper https://github.com/bajpai-lab/Acidosis-Cancer- RNAseq RNA-seq raw data This paper GSE315655 (see https://www.ncbi.nlm.nih.gov/ geo/query/acc.cgi?acc=GSE315655) Experimental models: Cell lines MDA-MB-231 wild-type ATCC Cat # HTB-26 MDA-MB-231 expressing Lifeact-GFP (Bera et al.)20 N/A MDA-MB-231 expressing pHred (Bera et al.)20 N/A HT1080 wild-type ATCC Cat # CCL-121 HCT116 ATCC Cat # CCL-247 A375 ATCC Cat # CRL-1619 HOS ATCC Cat # CRL-1543 Experimental models: Organisms/strains NOD-SCID Gamma (NSG) mice Jackson Laboratory strain #005557 Chick embryo University of Alberta poultry research facility Gallus gallus Oligonucleotides shRNA targeting human EZRIN CCGTGGGATGCTCAAAGATAA This paper N/A ShRNA targeting human NHE1 (1) GACAAGCTCAACCGGTTTAAT ShRNA targeting human NHE1 (2) CCAATCTTAGTTTCTAACCAA This paper N/A non-targeting scramble control GCACTACCAGAGCTAACTCAGATAGTACT This paper N/A (Continued on next page) 18 Cell Reports 45, 116970, February 24, 2026

    Expressing:

    Article Title: Hypoxia restores the acidosis-induced inhibition of cancer cell dissemination.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER latrunculin A Millipore Sigma 2-Deoxy-D-Glucose Cayman Chemical Cat # 14325 n-acetyl cysteine Cayman Chemical Cat # 20261 etomoxir Cayman Chemical Cat # 11969 oligomycin Cayman Chemical Cat # 11342 rotenone Cayman Chemical Cat # 13995 antimycin A Cayman Chemical Cat # 34799 NaHCO3 Gibco Cat # 12800-058 LIVE/DEADTM Viability/Cytotoxicity Kit Invitrogen Cat #L3224 BCECF-AM Thermo Fisher Cat #B1170 pHrodoTM Red-AM Molecular Probes Cat #P35372 Tetramethylrhodamine methyl ester perchlorate Thermo Fisher Cat #T668 Glucose Agilent Cat # 103577-100 Pyruvate Agilent Cat # 103578-100 Glutamine Agilent Cat # 103579-100 Seahorse XF DMEM Medium Agilent Cat # 103575-100 BODIPY Thermo Fisher Cat #D3922 CellROXTM Deep Red Reagent Thermo Fisher Cat #C10422 2-[4-(2-hydroxyethyl)piperazin-1-yl]ethanesulfonic acid Gibco Cat # 15630080 PIPES Millipore Sigma Cat #P1851 Critical commercial assays Duolink In Situ Red Starter Kit Mouse/Rabbit Sigma-Aldrich Cat # DUO92101 Cell Counting Kit-8 Dojindo Cat # CK04-11 Deposited data RNA-seq analysis This paper https://github.com/bajpai-lab/Acidosis-Cancer- RNAseq RNA-seq raw data This paper GSE315655 (see https://www.ncbi.nlm.nih.gov/ geo/query/acc.cgi?acc=GSE315655) Experimental models: Cell lines MDA-MB-231 wild-type ATCC Cat # HTB-26 MDA-MB-231 expressing Lifeact-GFP (Bera et al.)20 N/A MDA-MB-231 expressing pHred (Bera et al.)20 N/A HT1080 wild-type ATCC Cat # CCL-121 HCT116 ATCC Cat # CCL-247 A375 ATCC Cat # CRL-1619 HOS ATCC Cat # CRL-1543 Experimental models: Organisms/strains NOD-SCID Gamma (NSG) mice Jackson Laboratory strain #005557 Chick embryo University of Alberta poultry research facility Gallus gallus Oligonucleotides shRNA targeting human EZRIN CCGTGGGATGCTCAAAGATAA This paper N/A ShRNA targeting human NHE1 (1) GACAAGCTCAACCGGTTTAAT ShRNA targeting human NHE1 (2) CCAATCTTAGTTTCTAACCAA This paper N/A non-targeting scramble control GCACTACCAGAGCTAACTCAGATAGTACT This paper N/A (Continued on next page) 18 Cell Reports 45, 116970, February 24, 2026

    shRNA:

    Article Title: Hypoxia restores the acidosis-induced inhibition of cancer cell dissemination.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER latrunculin A Millipore Sigma 2-Deoxy-D-Glucose Cayman Chemical Cat # 14325 n-acetyl cysteine Cayman Chemical Cat # 20261 etomoxir Cayman Chemical Cat # 11969 oligomycin Cayman Chemical Cat # 11342 rotenone Cayman Chemical Cat # 13995 antimycin A Cayman Chemical Cat # 34799 NaHCO3 Gibco Cat # 12800-058 LIVE/DEADTM Viability/Cytotoxicity Kit Invitrogen Cat #L3224 BCECF-AM Thermo Fisher Cat #B1170 pHrodoTM Red-AM Molecular Probes Cat #P35372 Tetramethylrhodamine methyl ester perchlorate Thermo Fisher Cat #T668 Glucose Agilent Cat # 103577-100 Pyruvate Agilent Cat # 103578-100 Glutamine Agilent Cat # 103579-100 Seahorse XF DMEM Medium Agilent Cat # 103575-100 BODIPY Thermo Fisher Cat #D3922 CellROXTM Deep Red Reagent Thermo Fisher Cat #C10422 2-[4-(2-hydroxyethyl)piperazin-1-yl]ethanesulfonic acid Gibco Cat # 15630080 PIPES Millipore Sigma Cat #P1851 Critical commercial assays Duolink In Situ Red Starter Kit Mouse/Rabbit Sigma-Aldrich Cat # DUO92101 Cell Counting Kit-8 Dojindo Cat # CK04-11 Deposited data RNA-seq analysis This paper https://github.com/bajpai-lab/Acidosis-Cancer- RNAseq RNA-seq raw data This paper GSE315655 (see https://www.ncbi.nlm.nih.gov/ geo/query/acc.cgi?acc=GSE315655) Experimental models: Cell lines MDA-MB-231 wild-type ATCC Cat # HTB-26 MDA-MB-231 expressing Lifeact-GFP (Bera et al.)20 N/A MDA-MB-231 expressing pHred (Bera et al.)20 N/A HT1080 wild-type ATCC Cat # CCL-121 HCT116 ATCC Cat # CCL-247 A375 ATCC Cat # CRL-1619 HOS ATCC Cat # CRL-1543 Experimental models: Organisms/strains NOD-SCID Gamma (NSG) mice Jackson Laboratory strain #005557 Chick embryo University of Alberta poultry research facility Gallus gallus Oligonucleotides shRNA targeting human EZRIN CCGTGGGATGCTCAAAGATAA This paper N/A ShRNA targeting human NHE1 (1) GACAAGCTCAACCGGTTTAAT ShRNA targeting human NHE1 (2) CCAATCTTAGTTTCTAACCAA This paper N/A non-targeting scramble control GCACTACCAGAGCTAACTCAGATAGTACT This paper N/A (Continued on next page) 18 Cell Reports 45, 116970, February 24, 2026

    Control:

    Article Title: Hypoxia restores the acidosis-induced inhibition of cancer cell dissemination.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER latrunculin A Millipore Sigma 2-Deoxy-D-Glucose Cayman Chemical Cat # 14325 n-acetyl cysteine Cayman Chemical Cat # 20261 etomoxir Cayman Chemical Cat # 11969 oligomycin Cayman Chemical Cat # 11342 rotenone Cayman Chemical Cat # 13995 antimycin A Cayman Chemical Cat # 34799 NaHCO3 Gibco Cat # 12800-058 LIVE/DEADTM Viability/Cytotoxicity Kit Invitrogen Cat #L3224 BCECF-AM Thermo Fisher Cat #B1170 pHrodoTM Red-AM Molecular Probes Cat #P35372 Tetramethylrhodamine methyl ester perchlorate Thermo Fisher Cat #T668 Glucose Agilent Cat # 103577-100 Pyruvate Agilent Cat # 103578-100 Glutamine Agilent Cat # 103579-100 Seahorse XF DMEM Medium Agilent Cat # 103575-100 BODIPY Thermo Fisher Cat #D3922 CellROXTM Deep Red Reagent Thermo Fisher Cat #C10422 2-[4-(2-hydroxyethyl)piperazin-1-yl]ethanesulfonic acid Gibco Cat # 15630080 PIPES Millipore Sigma Cat #P1851 Critical commercial assays Duolink In Situ Red Starter Kit Mouse/Rabbit Sigma-Aldrich Cat # DUO92101 Cell Counting Kit-8 Dojindo Cat # CK04-11 Deposited data RNA-seq analysis This paper https://github.com/bajpai-lab/Acidosis-Cancer- RNAseq RNA-seq raw data This paper GSE315655 (see https://www.ncbi.nlm.nih.gov/ geo/query/acc.cgi?acc=GSE315655) Experimental models: Cell lines MDA-MB-231 wild-type ATCC Cat # HTB-26 MDA-MB-231 expressing Lifeact-GFP (Bera et al.)20 N/A MDA-MB-231 expressing pHred (Bera et al.)20 N/A HT1080 wild-type ATCC Cat # CCL-121 HCT116 ATCC Cat # CCL-247 A375 ATCC Cat # CRL-1619 HOS ATCC Cat # CRL-1543 Experimental models: Organisms/strains NOD-SCID Gamma (NSG) mice Jackson Laboratory strain #005557 Chick embryo University of Alberta poultry research facility Gallus gallus Oligonucleotides shRNA targeting human EZRIN CCGTGGGATGCTCAAAGATAA This paper N/A ShRNA targeting human NHE1 (1) GACAAGCTCAACCGGTTTAAT ShRNA targeting human NHE1 (2) CCAATCTTAGTTTCTAACCAA This paper N/A non-targeting scramble control GCACTACCAGAGCTAACTCAGATAGTACT This paper N/A (Continued on next page) 18 Cell Reports 45, 116970, February 24, 2026



    Similar Products

    mda mb 231 expressing phred  (ATCC)
    99
    ATCC mda mb 231 expressing phred
    Mda Mb 231 Expressing Phred, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mda+mb+231+expressing+phred/MDA-MB-231/pm41686638-283-179-188
    Average 99 stars, based on 1 article reviews
    mda mb 231 expressing phred - by Bioz Stars, 2026-09
    99/100 stars
    		  Buy from Supplier

    Image Search Results